Anything and everything cloning: Go...
New accounts disabled to block spam. The forum is just an archive now.
Pages: 1
My 1 PCR was perfectly amplified 250 bp insert and then purified from the gel in PCR product MEGA PRIMER used in 2nd PCR with the protocol mentioned in the website 2 and 3 step but I got colonies in 2 step PCR. but I have confirmed through colony PCR with respective primer but I didn't get amplification.
please help me
Offline
Hi there,
Sorry to hear you are having difficulty. I'd like to help, but you haven't provided very many details.
Please list our exactly what you have done (reagent concentrations, cycle conditions, concentration recovered from gel extraction and purity, transformation protocol, etc.), and preferably include the primer sequence so I can have a look at the project itself as well.
-Steve
Offline
Hi sir
I'd like to inform that information of ingredients are Phusion Taq polymerase with hf buffer. I have used as per ur concentration mentioned at your website nothing has changed, the program of 1pcr 98'1 min, 98'8sec, 52'20 sec 72'15 seconds for 35 cycle then 72'5min and 2 PCR 98'1min followed by 98'8sec 72'6min for 15 cycles and 72'5min. My insert size is around 250bp after purified (2ug) I used to 2pcr 70ng insert and vector size is 16 kb I used to 300ng. I have used chemically treated competent cells using the protocol as followed in Sambrook. Before transformation, PCR product treated with DpnI enzyme and negative control of plasmid also treated DpnI in the same condition. I got the colonies were PCR product of 10ul transformation no colonies were found in negative plate.
primer sequences
F- AGGCTACCACCTCGAAAGCTTAGGGAGGGCAATCTTATGTTGAAGC
R- ACCACCATCAGAAGACCCTCGAAAGGAGGGTTACCATCTAAAAAGG
If you want project details please share your email id then i forward pdf file of saved project copy
sir please help me in this project
thank you
Abdul
Offline
Hi Abdul,
Your destination plasmid is very large, so I'd anticipate you will struggle to get this to work.
How many colonies did you screen? If you are seeing hundreds of colonies on your plate, I would suggest pooling them into groups of 10 to reduce the number of PCR reactions on empty vector colonies. Hopefully you will see one or two pools with the insert, then you can re-screen just that target pool to narrow it down to a clone with your insert.
Is there any chance you can switch to handle_url_tag('https://www.rf-cloning.org/fluxbb/viewtopic.php?id='.$matches[1], $matches[2])? This will be easier, if you can.
-Steve
Offline
Dear sir
I cant use the infusion kit because of restriction site is not available at the site cloning that's why I choose your methodology its easy and clone at any place no need restriction site. Thank you for your suggestion. One more thing the same plasmid I need to create a single nucleotide mutation in two different places. can you help me in this regards? shall I use the same methodology of 2 step PCR skip the 1st PCR? if it is possible to create a mutation in my desired plasmid. please give me your suggestions.
Offline
Hi again Abdul,
To generate two different single nucleotide mutations, you will need to create specific primers for each. Once you successfully create one, then you can use the mutated plasmid as template to create the other. And you are correct, the primary PCR reaction is simplified.
As mentioned in the Q&A:
Q: When I created a new project there is a note underneath the Reverse Primer that says "The insert is fully synthesized by the primers..."
What, exactly, does this mean?
A: Congrats! You're project is probably a really easy one and you get to skip the 1° PCR ?
Set up the 2° PCR reaction as you normally would but leave out any template and include 5 ng of each primer.
Now run the following PCR program:
Thermal Cycler Conditions
Denature 98°C 30sec 1X
Denature 98°C 8sec 5X
Anneal 55°C 20sec
Extension 72° 5sec
Hold 4°C
Add your template to the tubes and proceed normally with a full 2° PCR reaction.
I hope this helps,
-Steve
Offline
Dear Sir
I'd like to inform you that I got two positive clones in my colony PCR. Thank for your valuable suggestion and one more project I need your help. I had already discussed to create the mutation in two different places based on RF-PCR using the following the condition of 1 st PCR without a template, but in this reaction, I have used 5ng of primer around 14.50ul each primer. This much of concentration shall I use, or I will decrease the level of primers after completion of 1st PCR then I added the template of 190 np of plasmid then continuance the 2nd PCR. The 2nd PCR product was treated with DpnI and then proceed with transformation, but I did not get any colonies. Please give me your suggestion. thank you
Denature 98°C 30sec 1X
Denature 98°C 8sec 5X
Anneal 55°C 20sec
Extension 72° 5sec
Hold 4°C
2nd PCR
Denature 98°C 30sec 1X
Denature 98°C 8sec 15X
Extension 72° 30sec/kb
Final Extension 72°C 5min 1X
Offline
That's great about the positive clones! Congrats.
As for the second issue, I'll need you to clarify something for me. You aren't trying to make two mutations in the same reaction, are you?
Let's pretend you want to make a point mutation at position 100 and another point mutation at 400. To do this, you will first make the mutation at 100, purify the plasmid, confirm with Sanger sequencing, and only then will you start to make the second mutation at 400, using the new plasmid as template.
The cycle conditions you provided look fine to me, but why have you diluted your primers to 0.35 ng/μl (i.e., 5 ng / 14.5 ul)? That seems very low, as I usually have them at 5 ng/μl for a single basepair substitution project like yours. If they are diluted in TE buffer, you may be messing up the pH and Mg++ level a bit.
-Steve
Offline
Dear sir,
Sorry for the late reply, past four days I am not well,
ok sir mutation creation, I am doing one by one and then confirm by sequencing first mutation then I will process the second one use as a template in the 1st mutated plasmid.
I have done the primer dilution as per IDT description if this wrong I will synthesis the new primers then again I dilute the primer 5ng/ul concentration or shall I use these primers for my experiment please give your suggestion.
I have diluted the primers in nuclease-free water, not in TE buffer.
Offline
I hope you're feeling better.
I think you can move ahead with your project with the primers as they are, but in the future I would recommend keeping concentrated stocks (usually 100μM in buffer, then dilute to working conc. in water).
I have my fingers crossed for you. Good luck!
-Steve
Offline
Dear sir
I have tried more than five times to create the mutation at 17kb plasmid in an inappropriate place by the same protocol I followed but I could not get colonies after transformation. please give me your suggestion. This is my main very important work. please, sir.....
Offline
This is a difficult project because of the size. I'm not sure there is much more I can do for you.
Are you gently spinning down the cells after transformation and plating all of them? Do you have ultra competent cells you can use?
Just to cover all your bases, you can also run a positive control (no DpnI) to make sure everything up to the transformation is going correctly.
If this construct is key to your work you can also hire a company to synthesize it. I think you would be looking at USD$1500-$2000 for a 17Kb plasmid (maybe less if you don't need all of the elements in that plasmid).
One other possible solution is to cut out the region you are working on and move it into a smaller plasmid, do the rf-cloning reaction, and then swap it back into the large plasmid. I'm pretty sure I found your project in the database, and it looks like you have restriction site options around your insert.
I hope this helps.
-Steve
Offline
Pages: 1