RF-Cloning.org Forum

Anything and everything cloning: Go...

New accounts disabled to block spam. The forum is just an archive now.

#1 2017-07-18 01:04:09

snissim
Member
Registered: 2017-07-18
Posts: 1

only original (un-edited) plasmids grow

Hi everyone,

Outstanding resource. A very big thank you to Steve Bond and other creators and operators of this website.

We have had trouble getting RF-cloning to work, yielding many colonies that are only original un-edited plasmid.
We do not get any edited plasmid.

proj_id=2aefa8628704771ea7b74a72901c920f


Here is the protocol we follow:
• Using the RF-cloning primer design tool, we get the following instructions:
Forward Primer
Plasmid annealing = 61°C     Target annealing = 55°C    Length = 43
GCTAACGTTATGTGTTGGCTACCACATgctagcGAAATATTAT

Reverse Primer
Plasmid annealing = 53°C     Target annealing = 55°C    Length = 51
ACGACTACTAATAAATAAAACGAATATAATATTTCgctagcATGTGGTAGC

The insert is fully synthesized by the primers. Use a 5 cycle PCR reaction (w/o any plasmid) to anneal and extend 5ng of each primer.
1° PCR Size        New Plasmid Size      Insert Sites       Insert Size
68bps                9346bps                   6785-6798        6bps

Essentially, we are ablating a Crispr target site in a plasmid by replacing the target site with the restriction site gctagc (lowercase in the primers above).

• With the instructions "The insert is fully synthesized by the primers. Use a 5 cycle PCR reaction (w/o any plasmid) to anneal and extend 5ng of each primer", we followed the protocol according to the Q&A:

• Perform 1˚PCR:
PCR components
5X      PCR Buffer         4μl
10mM dNTP mix           0.4μl
F primer                    5 ng
R primer                    5 ng
2U/μl   iProof Taq      0.2μl
H2O                      to  20μl

• Now run the following PCR program:
Thermal Cycler Conditions
Denature    98°C    30sec 1X
Denature    98°C    8sec    5X
Anneal    55°C  20sec   
Extension    72°   5sec   
Hold    4°C       

This will fill in the annealed oligos as follows:
GCTAACGTTATGTGTTGGCTACCACATGCTAGCGAAATATTAT
                 CGATGGTGTACGATCGCTTTATAATATAAGCAAAATAAATAATCATCAGCA
                ↓
GCTAACGTTATGTGTTGGCTACCACATGCTAGCGAAATATTATATTCGTTTTATTTATTAGTAGTCGT
CGATTGCAATACACAACCGATGGTGTACGATCGCTTTATAATATAAGCAAAATAAATAATCATCAGCA
                ↓
Then these will be “mega-primers” for 2˚ PCR reaction.

• Add plasmid template to above 1˚ PCR reaction:
Add 1 uL = 100 ng of plasmid 
This is based on the recommended conditions from RF-cloning website for these specific primers:
2° PCR conditions
Extension Time   ng of insert    ng of plasmid
3:05 mins          16.3              112.2

• Run 2˚ PCR:
3-Step Thermal Cycler Conditions
Denature    98°C    30sec  1X
Denature    98°C    8sec 15X
Anneal    ~60°C   20sec   
Extension   72°  3:05 min   
Final Extension  72°C  5min  1X
(extension time recommended 15-30 sec / kB, the RF-cloning site indicated for this specific plasmid / primers to use 3:05, which comes out to ~ 22 sec / kB)

• Add 20 units of DpnI directly to the reaction mix. Incubate 2 hours 37˚C.

• Inactivate DpnI 80˚C x 20 min.

• Transform into Top10 Competent cells
       |
       |
       |
       V
Pick 10-20 colonies
All colonies are original, un-edited plasmid. We do not get any colonies with edited plasmid.

Any troubleshooting thoughts?

Thank you greatly!

Last edited by snissim (2017-07-18 16:10:56)

Offline

#2 2017-07-18 22:04:34

Steve Bond
Administrator
Registered: 2014-01-23
Posts: 130

Re: only original (un-edited) plasmids grow

Hi Snissim,
Have you included any negative controls? Things to try (do all steps except what is listed in each control):
Cont. 1) Do not add any megaprimer
Cont. 2) Do not run the 15 cycle 2°

In theory, you should not see any colonies in either control. If you are seeing colonies, than either your DpnI could be failing, or your DNA may be under-methylated.
While trying these controls, also add one other reaction with 1/10 the plasmid. It's a fairly big plasmid you are using, which is going to make things a bit more difficult.
-Steve

Offline

Board footer

Powered by FluxBB