Anything and everything cloning: Go...
You are not logged in.
Pages: 1
Dear sir
I have tried more than five times to create the mutation at 17kb plasmid in an inappropriate place by the same protocol I followed but I could not get colonies after transformation. please give me your suggestion. This is my main very important work. please, sir.....
Dear sir,
Sorry for the late reply, past four days I am not well,
ok sir mutation creation, I am doing one by one and then confirm by sequencing first mutation then I will process the second one use as a template in the 1st mutated plasmid.
I have done the primer dilution as per IDT description if this wrong I will synthesis the new primers then again I dilute the primer 5ng/ul concentration or shall I use these primers for my experiment please give your suggestion.
I have diluted the primers in nuclease-free water, not in TE buffer.
Dear Sir
I'd like to inform you that I got two positive clones in my colony PCR. Thank for your valuable suggestion and one more project I need your help. I had already discussed to create the mutation in two different places based on RF-PCR using the following the condition of 1 st PCR without a template, but in this reaction, I have used 5ng of primer around 14.50ul each primer. This much of concentration shall I use, or I will decrease the level of primers after completion of 1st PCR then I added the template of 190 np of plasmid then continuance the 2nd PCR. The 2nd PCR product was treated with DpnI and then proceed with transformation, but I did not get any colonies. Please give me your suggestion. thank you
Denature 98°C 30sec 1X
Denature 98°C 8sec 5X
Anneal 55°C 20sec
Extension 72° 5sec
Hold 4°C
2nd PCR
Denature 98°C 30sec 1X
Denature 98°C 8sec 15X
Extension 72° 30sec/kb
Final Extension 72°C 5min 1X
Dear sir
I cant use the infusion kit because of restriction site is not available at the site cloning that's why I choose your methodology its easy and clone at any place no need restriction site. Thank you for your suggestion. One more thing the same plasmid I need to create a single nucleotide mutation in two different places. can you help me in this regards? shall I use the same methodology of 2 step PCR skip the 1st PCR? if it is possible to create a mutation in my desired plasmid. please give me your suggestions.
Hi sir
I'd like to inform that information of ingredients are Phusion Taq polymerase with hf buffer. I have used as per ur concentration mentioned at your website nothing has changed, the program of 1pcr 98'1 min, 98'8sec, 52'20 sec 72'15 seconds for 35 cycle then 72'5min and 2 PCR 98'1min followed by 98'8sec 72'6min for 15 cycles and 72'5min. My insert size is around 250bp after purified (2ug) I used to 2pcr 70ng insert and vector size is 16 kb I used to 300ng. I have used chemically treated competent cells using the protocol as followed in Sambrook. Before transformation, PCR product treated with DpnI enzyme and negative control of plasmid also treated DpnI in the same condition. I got the colonies were PCR product of 10ul transformation no colonies were found in negative plate.
primer sequences
F- AGGCTACCACCTCGAAAGCTTAGGGAGGGCAATCTTATGTTGAAGC
R- ACCACCATCAGAAGACCCTCGAAAGGAGGGTTACCATCTAAAAAGG
If you want project details please share your email id then i forward pdf file of saved project copy
sir please help me in this project
thank you
Abdul
My 1 PCR was perfectly amplified 250 bp insert and then purified from the gel in PCR product MEGA PRIMER used in 2nd PCR with the protocol mentioned in the website 2 and 3 step but I got colonies in 2 step PCR. but I have confirmed through colony PCR with respective primer but I didn't get amplification.
please help me
Pages: 1