Anything and everything cloning: Go...
New accounts disabled to block spam. The forum is just an archive now.
Pages: 1
Hi everyone,
Outstanding resource. A very big thank you to Steve Bond and other creators and operators of this website.
We have had trouble getting RF-cloning to work, yielding many colonies that are only original un-edited plasmid.
We do not get any edited plasmid.
proj_id=2aefa8628704771ea7b74a72901c920f
Here is the protocol we follow:
• Using the RF-cloning primer design tool, we get the following instructions:
Forward Primer
Plasmid annealing = 61°C Target annealing = 55°C Length = 43
GCTAACGTTATGTGTTGGCTACCACATgctagcGAAATATTAT
Reverse Primer
Plasmid annealing = 53°C Target annealing = 55°C Length = 51
ACGACTACTAATAAATAAAACGAATATAATATTTCgctagcATGTGGTAGC
The insert is fully synthesized by the primers. Use a 5 cycle PCR reaction (w/o any plasmid) to anneal and extend 5ng of each primer.
1° PCR Size New Plasmid Size Insert Sites Insert Size
68bps 9346bps 6785-6798 6bps
Essentially, we are ablating a Crispr target site in a plasmid by replacing the target site with the restriction site gctagc (lowercase in the primers above).
• With the instructions "The insert is fully synthesized by the primers. Use a 5 cycle PCR reaction (w/o any plasmid) to anneal and extend 5ng of each primer", we followed the protocol according to the Q&A:
• Perform 1˚PCR:
PCR components
5X PCR Buffer 4μl
10mM dNTP mix 0.4μl
F primer 5 ng
R primer 5 ng
2U/μl iProof Taq 0.2μl
H2O to 20μl
• Now run the following PCR program:
Thermal Cycler Conditions
Denature 98°C 30sec 1X
Denature 98°C 8sec 5X
Anneal 55°C 20sec
Extension 72° 5sec
Hold 4°C
This will fill in the annealed oligos as follows:
GCTAACGTTATGTGTTGGCTACCACATGCTAGCGAAATATTAT
CGATGGTGTACGATCGCTTTATAATATAAGCAAAATAAATAATCATCAGCA
↓
GCTAACGTTATGTGTTGGCTACCACATGCTAGCGAAATATTATATTCGTTTTATTTATTAGTAGTCGT
CGATTGCAATACACAACCGATGGTGTACGATCGCTTTATAATATAAGCAAAATAAATAATCATCAGCA
↓
Then these will be “mega-primers” for 2˚ PCR reaction.
• Add plasmid template to above 1˚ PCR reaction:
Add 1 uL = 100 ng of plasmid
This is based on the recommended conditions from RF-cloning website for these specific primers:
2° PCR conditions
Extension Time ng of insert ng of plasmid
3:05 mins 16.3 112.2
• Run 2˚ PCR:
3-Step Thermal Cycler Conditions
Denature 98°C 30sec 1X
Denature 98°C 8sec 15X
Anneal ~60°C 20sec
Extension 72° 3:05 min
Final Extension 72°C 5min 1X
(extension time recommended 15-30 sec / kB, the RF-cloning site indicated for this specific plasmid / primers to use 3:05, which comes out to ~ 22 sec / kB)
• Add 20 units of DpnI directly to the reaction mix. Incubate 2 hours 37˚C.
• Inactivate DpnI 80˚C x 20 min.
• Transform into Top10 Competent cells
|
|
|
V
Pick 10-20 colonies
All colonies are original, un-edited plasmid. We do not get any colonies with edited plasmid.
Any troubleshooting thoughts?
Thank you greatly!
Pages: 1