Anything and everything cloning: Go...
You are not logged in.
Pages: 1
Dear Steve,
I have some problems with secondary PCR and with no colonies after transformation.
My project id is: https://www.rf-cloning.org/rf_cloning_project.php?proj_id=c4ca73f79abf68ca539ef3fb32432d55
I use Phusion High-Fidelity DNA Polymerase [Agilent Technologies] in 2-step and 3-step PCR method (with annealing temperature of 71°C).
If I obtained colonies after transformation these were only a few (6-8 colonies) and these were very small. I’ve checked them in PCR using primers designed for destination plasmid and also for insert (TAGs_For: GGTCACATCCACAGTTTGAGAAGGG, TAGs_Rev: CCCTTGAAAGTATAGGTTCTCCTTG). Results identified destination plasmid but no presence of insertion. I didn't sequencing plasmid because of potentially lack of insertion.
Thank you in advance for any suggestions.
Best regards,
Anna
Pages: 1